Specimen Information

Sample Storage
Sample ID: CNCLEP00075251
Catalog Number: CNCLEP00075251
Voucher Type: Dry mounting specimen
Voucher Description:
Institution Storing:
Identification Provided by: Eugene Munroe
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Mexico
State: Oaxaca
Region: Vista Hermosa
Exact Site:
Latitude: 17.1079
Longitude: -96.7461
Coordinate:
Collectors: E. C. Welling
Collectiondate: 1962-09-22
Specimen Details
Sex: male
Life Stage: adult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ZYPAN934-10
Marker Code: COI-5P
Residues: 599
AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCGGAATTAGGAAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGGGCCCCTGATATAGCTTTCCCACGAATAAACAATATAAGATTTTGATTATTACCCCCATCATTAACTCTTTTAATTTCAAGAAGAATTGTTGAAAACGGAGCAGGAACTGGATGAACTGTTTATCCCCCACTTTCATCTAATATTGCTCACGGAGGAAGATCAGTTGATTTAGCAATTTTTTCGTTACATCTAGCTGGTATCTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATCATTAATATACGAATTAATGGAATATCATTTGATCAAATACCATTATTTGTATGAGCAGTAGGTATTACAGCTTTATTATTACTACTATCTCTTCCAGTTTTAGCAGGTGCTATTACTATATTACTAACAGATCGAAATTTAA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!