Specimen Information

Sample Storage
Sample ID: FWL1IH4
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Kalima Mwange
Taxonomy
Phylum: Zygomycota
Class: Zygomycetes
Order: Mortierellales
Family: Mortierellaceae
Genus: Mortierella
Species: Mortierella sp.
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region: Woodslee
Exact Site: Forest, Rep 1
Latitude: 42.2
Longitude: -82.75
Coordinate:
Collectors: Tharcisse Barasubiye
Collectiondate: 2008-04-30
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: isolated from soil
   
   
   
   
   
   

Sequence Details

Sequence ID: WSF125-09
Marker Code: ITS
Residues: 669
CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTCAGTCGGTTTTCTTTTTCGTCAAGAAAAAAGGATCGACCAAACATCAACTTATTCTAATTGAACTTTTGTCTGAAAACTATTATGAATAAACTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAAAACTCTTGATCTTTTTCAAGCGTTTTGGACTTGAGCAAACCCAACGCCTTTTCTTTTAAGATCTGTTGCGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACAATCTCCTGAGCTAAAAGCATATTTATTTAGTCCCGTCAAACGGATTATTACTTTTTGCTGCAGCTAACATAAAGGGAGTTTTGACCATTATGGCTGACTGATGCAGGATTTCACAGAGAAAAGGCCGGCAACGGTTTTGTCTCTGTCAAACTCGATCTCAAATCAAGAAGACTACCCGCTGAACTTAAGCATATCATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.