Specimen Information

Sample Storage
Sample ID: DFO193
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chordata
Class: Actinopterygii
Order: Scorpaeniformes
Family: Liparidae
Genus: Acantholiparis
Species: Acantholiparis opercularis
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site:
Latitude: 52.4
Longitude: -132.201
Coordinate:
Collectors: Jim Boutillier, Pacific Biological Station, B.C.
Collectiondate: 2006-10-13
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: CCGS W.E Ricker[Tow 18]
   
   
   
   
   
   

Sequence Details

Sequence ID: TZFPA129-06
Marker Code: COI-5P
Residues: 651
CCTTTATCTAATATTTGGTGCTTGAGCGGGGACGGTAGGAATAGGCTTGAGTTTACTAATTCGGGCCGAACTTAGCCAACCCGGAACCCTTTTAGGCAACGATCAACTTTACAACGTAATTGTCACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCCGCCATAATCGGAGGGTTCGGAAATTGACTCGTCCCCCTAATGCTCGGTGCCCCTGATATAGCCTTTCCTCGAATAAATAACATAAGCTTTTGACTTCTTCCACCCTCCTTCTTACTCCTTCTTGCCTCTTCTGGCGTAGAAGCAGGAGCTGGGACCGGGTGAACTGTCTATCCTCCTCTTGCCAGTAATTTAGCCCATGCCGGAGCTTCTGTAGACCTAACAATTTTTTCGCTACATTTAGCAGGAATTTCTTCAATTCTTGGGGCAATTAATTTTATTACAACCATCATTAACATGAAACCCCCTACCATATCTCAATATCAGACCCCTCTTTTCGTGTGGTCTATACTTATTACCGCCGTACTTCTCCTTCTTTCTCTCCCTATCCTTGCTGCCGGTATCACCATGCTTCTAACAGATCGTAACCTTAACACAACATTCTTTGACCCTGCAGGGGGTGGAGACCCAATTCTTTACCAACACCT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!