Specimen Information

Sample Storage
Sample ID: Abbott9148
Catalog Number: Abbott9148
Voucher Type:
Voucher Description:
Institution Storing: University of Johannesburg
Identification Provided by: Tony Abbott
Taxonomy
Phylum: Magnoliophyta
Class: Magnoliopsida
Order: Malpighiales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: South Africa
State: KwaZulu-Natal
Region:
Exact Site: Msikaba, Fish Eagle Trail, sandy loam
Latitude: -31.0447
Longitude: 30.1649
Coordinate:
Collectors: Tony Abbott
Collectiondate: 2010-03-23
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: TSA373-10
Marker Code: rbcLa
Residues: 555
AGTGTT---GGGTTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAGCAGGAGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACAGACGGGCTTACCAGTCTTGATCGTTATAAAGGACGATGCTACGACATTGAGCCCGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCAATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGCGCCCTACGTCTGGAGGATTTGCGAATCCCTACTGCTTATATTAAAACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGACCCCTATTGGGTTGTACTATTAAACCTAAATTGGGGCTATCCGCTAAGAATTACGGTAGAGCCGTTTATGAATGTCTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!