Specimen Information

Sample Storage
Sample ID: FJ536666
Catalog Number: ryeuw
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chlorophyta
Class:
Order:
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: India
State: Kerala
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: TRENT043-10
Marker Code: rbcL
Residues: 879
GACCGTTATAAAGGACGTTGTTATGACATTGAAGCAATTCCAGGAGAAGAAGATAGTTTCTTTGCTTATGTTGCATACCCAATTGACTTATTTGAGGAAGGATCTGTAACAAACTTATTAACTTCTGTTGTAGGAAACGTATTCGGTTTCAAAGCGTTAAGAGCTCTTCGATTAGAAGATTTACGTATTTCTAAAGCATACGTTAAAACTTTCTTTGGTCCACCACACGGAATTCAAGTTGAACGTGATAAATTAAACAAATACGGTCGTGCGTTTTTAGGATGTACTATTAAACCAAAATTAGGATTATCAGCTAAAAACTATGGTCGTGCTTGTTATGAATGTTTACGTGGAGGATTAGACTTTACAAAAGATGATGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTTGCATTTGTAGCAGAAGGAATTTTCAAATCTCAAGCAGAAACAGGAGAAATTAAAGGGCACTACTTAAATGCAACTGCTCCTGATTCAGAAGGAATGATGCTTCGTGCAGAAACTGCTAAAGGTTTTGGGGTTCCTATTATTATGCACGACTATTTAACAGGAGGATATACAGCAAACACAACTTTAGCTAACTTCTGTCGAAACAATGGATTACTTCTTCACATTCACCGTGCGATGCACGCTGTAATTGACCGTCAACGTAACCATGGTATTCACTTCCGTGTTTTAGCAAAAACATTAAGACTTTCTGGAGGGGACCACTTACACTCTGGAACAGTTGTAGGAAAACTAGAAGGAGATAGAGAAATCACTTCAGGATTCGTAGACTTAATGAGAGATAACTTCATTGAACGTGACCGTCAGAGAGGAGTATTCTTCTCTCAAGAATGGAAGGGT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!