Specimen Information

Sample Storage
Sample ID: FJ534632.1
Catalog Number: 37
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chlorophyta
Class: Ulvophyceae
Order: Trentepohliales
Family: Trentepohliaceae
Genus: Printzina
Species: Printzina lagenifera
Sample Collection
Ocean:
Country: Panama
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: TRENT037-10
Marker Code: rbcL
Residues: 879
GACCGTTATAAAGGACGTTGTTATGATATCGAAGCAATTCCAGGAGAAGAGCAAAGTTTCTTTGCTTATGTAGCATACCCAATCGATTTATTCGAAGAAGGGTCAGTAACAAACTTATTAACTTCAGTAGTAGGAAACGTATTCGGTTTCAAAGCTTTAAGAGCTCTTCGTCTAGAAGACTTACGTATTTCTAAAGCGTACGTTAAAACTTTCTTTGGTCCACCACACGGAATTCAAGTTGAACGTGATAAATTAAACAAGTACGGTCGAGCATTCTTAGGTTGTACAATTAAACCAAAATTAGGATTATCAGCTAAAAACTATGGACGTGCTTGTTATGAATGTTTACGTGGAGGATTAGATTTCACAAAAGACGATGAAAACGTAAACTCACAACCATTCATGCGCTGGAGAGACCGTTTTGCTTTCGTAGCGGAAGGAATTTTCAAATCACAAGCGGAAACTGGAGAAATTAAAGGACACTACTTAAATGCAACTGCTCCTGACTCAGAAAACATGATGTTACGAGCAGAAACTGCTAAAGGTTTTGGGGTTCCTATTATTATGCACGACTATTTAACAGGAGGATACACAGCAAACACTACTTTAGCAAATTTCTGTAGAAACAATGGATTACTTCTTCACATTCACCGTGCGATGCACGCAGTAATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTATTAGCAAAAACGCTAAGAATGTCTGGTGGTGACCACTTACACTCTGGAACAGTTGTAGGAAAATTAGAAGGTGATAGAGAAGTAACTCAAGGGTTCGTAGATTTAATGCGTGATAACATTATTGAGAAAGATCGTTCAAGAGGGGTATTCTTCTATCAAGATTGGATGGGT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!