Specimen Information

Sample Storage
Sample ID: Alar Rapi 4
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Sean A. Locke
Taxonomy
Phylum: Platyhelminthes
Class: Trematoda
Order: Strigeidida
Family: Diplostomidae
Genus: Alaria
Species: Alaria mustelae
Sample Collection
Ocean:
Country: Canada
State: Quebec
Region: Saint Lawrence River
Exact Site: Ile de la Commune
Latitude: 45.619
Longitude: -73.472
Coordinate:
Collectors: Sean Locke
Collectiondate: 2006-09-05
Specimen Details
Sex: hermaphrodite
Life Stage: immature
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: TREMA160-07
Marker Code: 18S
Residues: 347
CCTTAAACGGTGAAACCGCGAATGGCTCATTAAATCAGCTATGGTTCCTTAGATCGTACATGCTACATGGATAACTGTAGTAATTCTAGAGCTAATACATGCCACTATGCCCTGACCCGCAAGGGAACGGGTGGATTTATTAGAACAGAACCAACCGGGAACGGCTTCGGTCGTTCCTGTTGCACTCTGTGATGACTCTGGATAACTTTACTGATCGCAGTCGGCCTTGTGTCGGCGACGGATCTTTCAAATGTCTGCCCTATCAACTTTCGATGGTAGGTGATCTGCCTACCATGGTGATAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.