Specimen Information

Sample Storage
Sample ID: FJ176217
Catalog Number: C2728US1
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Roberto Bertolani
Taxonomy
Phylum: Tardigrada
Class: Eutardigrada
Order: Parachela
Family: Macrobiotidae
Genus: Macrobiotus
Species: Macrobiotus macrocalix
Sample Collection
Ocean:
Country: Italy
State: Trentino-Alto Adige
Region: Trentino Alto Agige
Exact Site: Andalo (moss on rock)
Latitude: 46.102
Longitude: 11.0005
Coordinate:
Collectors: Roberto Bertolani
Collectiondate: 2007-03-15
Specimen Details
Sex:
Life Stage: immature
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: TABAR021-09
Marker Code: COI-5P
Residues: 741
TATGAGCTGCTTGTGTAGGAACTTCACTCAGCTTTATTATCCGAAGAGAACTAAGACAACCTGGCATCTTATTTGGAGATGAACAAATATATAATGTTACTGTTACTAGCCACGCTTTTATTATAATTTTCTTTTTTGTAATACCTATTCTAATTGGAGGATTTGGAAACTGACTTGTACCCTTAATAATTGGTGCCCCTGATATGGCATTCCCCCGAATAAATAATCTTAGATTTTGATTATTACCACCATCTTTCACACTTATTATAACTAGAACAATAAGAGAACAAGGAGCGGGAACAGGATGAACAGTATACCCCCCCTTATCTCATTTTTTTGCCCATAGAGGTCCCAGAGTAGACTTAACTATTTTTTCTCTGCATATTGCAGGTATTTCTTCAATCTTAGGAGCCATTAATTTTATTTCTACAATTTTAAATATACGAACTCCTAGAATAACTTTAGAAAATATACCTCTTTTTGTATGATCCGTTCTTATTACTGCTATTCTTTTGTTATTAGCCCTACCTGTATTAGCCGGAGGTATTACAATACTATTAATAGACCGAAACTTTAACACTTCTTTCTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATACCAACATCTCTTTTGATTCTTTGGGCATCCTGAAGTATACATTTTGATTTTACCAGGATTTGGAATTATTTCTCAAATCGTAATTCATTTTAGAGGAAAATATTTAACCTTTGGACATT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!