Specimen Information

Sample Storage
Sample ID: FJ176206
Catalog Number: C2712E5
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Roberto Guidetti
Taxonomy
Phylum: Tardigrada
Class: Eutardigrada
Order: Parachela
Family: Macrobiotidae
Genus: Macrobiotus
Species: Macrobiotus macrocalix
Sample Collection
Ocean:
Country: Italy
State: Modena
Region: Emilia Romagna
Exact Site: Gaianello (Pavullo) (moos on tree)
Latitude: 44.1879
Longitude: 10.4776
Coordinate:
Collectors: Roberto Bertolani
Collectiondate: 2007-12-18
Specimen Details
Sex:
Life Stage: immature
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: TABAR010-09
Marker Code: COI-5P
Residues: 741
TATGAGCTGCTTGTGTAGGAACTTCACTCAGCTTTATTATCCGAAGAGAACTAAGACAACCTGGCATCTTATTTGGAGATGAACAAATATATAATGTTACTGTTACTAGCCACGCTTTTATTATAATTTTCTTTTTTGTAATACCTATTCTTATTGGAGGATTTGGAAACTGACTTGTACCCTTAATAATTGGTGCCCCTGATATGGCATTCCCCCGAATAAACAATCTTAGATTTTGATTATTACCACCATCTTTCACACTTATTATAACTAGAACAATAAGAGAACAAGGAGCAGGAACAGGATGAACAGTATACCCCCCCTTATCTCATTTTTTTGCCCATAGAGGTCCCAGAGTAGACTTAACTATTTTTTCTCTGCATATTGCAGGTATTTCTTCAATCTTAGGAGCCATTAATTTTATTTCTACAATTTTAAATATACGAACTCCTAGAATAACTTTAGAAAATATACCTCTTTTTGTATGATCCGTTCTTATTACTGCTATTCTTTTGTTATTAGCCCTACCTGTATTAGCCGGAGGTATTACAATACTATTAATAGACCGAAATTTTAACACTTCTTTCTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATATCAACATCTCTTTTGATTCTTTGGGCATCCTGAAGTATACATTTTGATTTTACCAGGATTTGGAATTATTTCTCAAATCGTAATTCATTTTAGAGGAAAACATTTAACCTTTGGGCATT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!