Specimen Information

Sample Storage
Sample ID: KAS2107.ITS
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Keith Seifert
Taxonomy
Phylum: Ascomycota
Class: Eurotiomycetes
Order: Eurotiales
Family: Trichocomaceae
Genus: Penicillium
Species: Penicillium soppii
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region:
Exact Site: 5 km S of Carnavon at end of 12 Mile Lake
Latitude: 45.0297
Longitude: -78.6142
Coordinate:
Collectors: D. Malloch
Collectiondate: 1996-09-21
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: Other Database numbers: W127
   
   
   
   
   
   

Sequence Details

Sequence ID: PATE008-08
Marker Code: ITS
Residues: 582
TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTATACCTTGTTGCTTTGGCGGGCCCGCCTCACGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGTGCCCGCCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGTAAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGAGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCAAATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!