Specimen Information

Sample Storage
Sample ID: HLC-26784
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing: Biodiversity Institute of Ontario
Identification Provided by:
Taxonomy
Phylum: Chaetognatha
Class:
Order:
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Canada
State: Nunavut
Region: Resolute
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors: P.D.N. Hebert
Collectiondate: 2000-08-21
Specimen Details
Sex:
Life Stage:
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: NNOP077-08
Marker Code: COI-5P
Residues: 407
TAAGCTTCTGACTCCTACCTCCCGCACTGGCGCTACTCCTTTTGTCCGGTATGGTCGAAAGCGGTGTGGGGACTGGTTGAACGGTATACCCGCCTTTGAGC---ACTATCGGCCATGCGGGTGGGGCGGTTGATTTGGGTATCTTTTCTTTGCATCTGGCTGGTGTTAGAAGGATTTTAGGTAGTGCTAATTTTATTACAACAATTGTAAATATGAAAGGTGATGGTATAGCTATAGAGCTTATACCACTTTTTGTTTGAGCTGTCTTATTAACCGCTATCCTTTTGTTACTTTCTCTTCCTGTACTGGCAGGAGCTATCACTATGTTGTTAACAGACCGTAATTTTAACACTTCTTTCTTCGACCCTGCGGGAGGGGGCGATCCTATTTTATATCAGCACCTTTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!