Specimen Information

Sample Storage
Sample ID: HLC-25340
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Arthropoda
Class:
Order:
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Australia
State: Queensland
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate: 1998-05-19
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: LIMC200-08
Marker Code: COI-5P
Residues: 324
TTATATTTAATTTTTGGTGCTTGAGCTGGAATGGTGGGGACCTCTCTAAGTCTATTAATTCGTGCTGAGTTGGGTCAACCAGGAACTTTTATTGGGGATGACCAAATTTATAATGTGGTAGTTACGGCTCATGCTTTTGTAATGATTTTTTTTATGGTTATGCCAATTTTAATTGGGGGATTTGGAAATTGATTAGTGCCTTTAATATTAGGAGCTCCGGATATGGCTTTCCCGCGTCTGAATAATATAAGTTTTTGGCTTCTCCCTCCAGCGTTAGTTTTGTTATTGTCTGGAGCTGGGGTAGAAAATGGAGCTGGAACAGGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.