Specimen Information

Sample Storage
Sample ID: AP097-b
Catalog Number: OAC 89069
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Annabel Por
Taxonomy
Phylum: Pteridophyta
Class: Pteridopsida
Order: Polypodiales
Family: Dryopteridaceae
Genus: Dryopteris
Species: Dryopteris carthusiana
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region: Regional Municipality of York
Exact Site: Jokers Hill West., Old growth forest, E of trail.
Latitude: 44.034
Longitude: -79.533
Coordinate:
Collectors: Annabel Por
Collectiondate: 2006-06-08
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: Old growth of Acer saccharum-Tsuga canadensis, with Fraxinus, Caulophyllum thalictroides,, A. saccharum saplings., For Canada Plant Barcode Workgroup, Flora of Jokers Hill. Duplicate vouchers also held at Royal Ontario Museum Green Plant Herbarium (TRT) and at Koffler Scientific Reserve Jokers Hill Herbarium
   
   
   
   
   
   

Sequence Details

Sequence ID: KSR515-08
Marker Code: rbcLa
Residues: 583
AGGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACCCCCGAATACAAGACTAAAGATACCGATATCTTAGCAGCCTTTAGAATGACCCCGCAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTCGACCGTTACAAAGGCCGATGCTACGACATCGAACCCGTCGCTGGAGAGGAAAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCTGTCACCAATTTGTTCACCTCTATTGTAGGTAATGTCTTCGGATTTAAGGCTCTACGCGCTTTACGCTTGGAAGACCTTCGAATTCCCCCCGCTTATTCTAAAACTTTCATCGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTAAACAAATATGGACGTCCTTTATTGGGATGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAGAATTATGGTAGAGCCGTCTACGAANNNCTCCGCGGCGGACTTGATTTCACGAAAGATGAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!