Specimen Information

Sample Storage
Sample ID: AP286
Catalog Number: OAC 90187
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Annabel Por
Taxonomy
Phylum: Pteridophyta
Class: Pteridopsida
Order: Polypodiales
Family: Dryopteridaceae
Genus: Matteuccia
Species: Matteuccia struthiopteris
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region: Regional Municipality of York
Exact Site: Jokers Hill East., Approx. 200 m E of pond near Thornton Bales.
Latitude: 44.031
Longitude: -79.512
Coordinate:
Collectors: Annabel Por, John Gerrath
Collectiondate: 2006-08-08
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: With Balsam Poplar, Ash, Dogwood.. For Canada Plant Barcode Workgroup, Flora of Jokers Hill. Duplicate vouchers also held at Royal Ontario Museum Green Plant Herbarium (TRT) and at Koffler Scientific Reserve Jokers Hill Herbarium
   
   
   
   
   
   

Sequence Details

Sequence ID: KSR213-07
Marker Code: rbcLa
Residues: 591
AGGTGTTGGATTCAAAGCTGGTGTCAAAGATTACCGACTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTTAGCAGCCTTCCGAATGACCCCACAACCCGGGGTACCTGCTGAGGAAGCCGGAGCTGCGGTAGCTGCGGAATCCTCCACGGGTACGTGGACCACTGTATGGACAGATGGGTTGACCAGTCTTGACCGTTACAAGGGCCGATGCTACGACATTGAACCCGTCGCTGGAGAAGAGAACCAGTATATCGCGTATGTAGCTTATCCTTTGGATCTATTCGAAGAAGGTTCCGTCACCAATTTGTTCACCTCTATTGTAGGTAACGTTTTCGGATTTAAGGCTCTACGCGCTCTACGCTTGGAAGACCTTCGAATCCCTCCTGCTTATTCCAAAACTTTCATTGGACCGCCTCATGGTATTCAGGTCGAAAGGGATAAACTGAACAAATATGGACGTCCCTTATTGGGGTGTACAATCAAGCCAAAATTAGGTCTGTCTGCTAAAAATTATGGTAGAGCCGTCTACGAATGCCTTCGTGGTGGACTTGATTTTACAAAAGATGATGAAAACGT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!