Specimen Information

Sample Storage
Sample ID: Ichthy-019-B
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing: Biodiversity Institute of Ontario
Identification Provided by:
Taxonomy
Phylum: Chordata
Class:
Order:
Family:
Genus:
Species:
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage: adult
Reproduction:
Notes: Identified by Jenn, Miles and Dan
   
   
   
   
   
   

Sequence Details

Sequence ID: ICHLB065-08
Marker Code: COI-5P
Residues: 652
CCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACCGCTTTAAGCCTGCTTATTCGGGCAGAACTAAGCCAACCTGGCGCCCTTCTAGGGGATGACCAAATTTACAACGTAATTGTTACGGCCCACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGAAACTGACTGATTCCGCTAATGATCGGAGCCCCTGATATAGCCTTCCCTCGAATGAATAACATGAGCTTCTGACTACTCCCTCCCTCCTTCCTTTTGCTTTTAGCCTCTTCAGGTGTTGAAGCCGGGGCCGGAACTGGTTGAACAGTCTATCCCCCACTGGCTGGGAACCTTGCCCACGCCGGAGCATCCGTAGATTTAACCATCTTCTCCCTTCACCTAGCAGGGGTCTCATCAATTCTAGGGGCTATTAATTTTATTACCACTATTATCAACATGAAACCTCCTGCAGTCTCAATATATCAAATTCCACTATTTGTTTGAGCTGTCTTAATTACAGCTGTCCTTCTTCTCCTCTCTCTTCCTGTCCTAGCTGCTGGCATTACAATACTTTTAACAGACCGAAATCTAAATACTGCTTTCTTTGACCCAGCAGGCGGGGGAGACCCAATTCTTTATCAACACCTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.