Specimen Information

Sample Storage
Sample ID: JCM 3809
Catalog Number: 3809
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Gen Okada
Taxonomy
Phylum: Ascomycota
Class: Sordariomycetes
Order: Sordariomycetes_Incertae_sedis
Family: Sordariomycetes_family_incertae_sedis
Genus: Arthrosporium
Species: Arthrosporium hyalospora
Sample Collection
Ocean:
Country: Japan
State: Hokkaido
Region: Teshio-gun
Exact Site: 23rd River
Latitude:
Longitude:
Coordinate:
Collectors: H. Britz
Collectiondate: 1983-11-30
Specimen Details
Sex:
Life Stage:
Reproduction: asexual
Notes: living culture, anamorph
   
   
   
   
   
   

Sequence Details

Sequence ID: HTWO003-08
Marker Code: COI-5P
Residues: 628
ACAGCATTTTCTGTATTAATTAGATTAGAACTTAGTGGACCAGGTGTTCAATATATTTCAGATAACCAATTATATAATAGTATTATTACAGCTCACGCTATTTTAATGATATTCTTTATGGTTATGCCGGCTTTAATAGGAGGTTTTGGTAACTTCTTAATGCCTTTAATGGTAGGAGGACCAGATATGGCATTCCCTAGATTAAATAATATTAGTTTCTGATTATTACCCCCTAGTTTAATACTATTAGTTTTATCAGCATGTATAGAAGGTGGAGTTGGTACAGGTTGAACTTTATACCCTCCATTAGCTAGTTTACAAAGTCATAGCGGTCCAAGTGTAGATTTAGCTATATTTGCTTTACATCTATCAGGGGTAAGTAGTCTATTAGGAGCTATTAATTTCATTACTACAGTTGTTAATATGAGAACTCCAGGTATAAGACTACATAAATTAGCTTTATTTGGTTGAGCTGTTGTTATAACAGCTGTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGGTATAACTATGGTTTTAACAGATAGAAATTTTAATACATCATTCTTTGAAACAGCTGGAGGTGGTGACCCTATATTATACCAACATTTATTCTGATTCTTCG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.