Specimen Information

Sample Storage
Sample ID: EDNA09-02156
Catalog Number: E00386641
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Marchantiophyta
Class: Jungermanniopsida
Order: Jungermaniales
Family: Herbertaceae
Genus: Herbertus
Species: Herbertus norenus
Sample Collection
Ocean:
Country: United Kingdom
State: Scotland
Region: vc112: Shetland
Exact Site: Mainland, Black Butten, north slope of Ronas Hill
Latitude:
Longitude:
Coordinate:
Collectors: D. Bell
Collectiondate: 2009-10-26
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: HERB034-11
Marker Code: ITS
Residues: 557
GCTTGAGGAACGTGAAGTCAGAGACTGAGCCTGGGGTCCTAGTCTTGCTCTCACGGGTGAGAGTTCGGGGCCCCGAGTCGAAAACCAAAACAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTTGTCCCGAGGGCATGCCTGCCTGAGCGTCACCGCACTCCCACTCCCGTGGTTACATCTCGGTTCGAGGACCGGGGG---TGCTGCCGAGAGTGGAACTGGCCGTCCGGGACCCGGCGTGAAGCCGATG--GTCGTGGTTGGCTGAAATGCAGCGTTCTGGACGCAGCTTAAGAGAGGAGCCGCGAGAAGGTGATCCGCCCCTCGCCGGGCGGAGTCAAAAGACAGCGGTTCTCTCGCTTGGGTGGTCCGGGACGACCGCGGCGGGGCACAGCCCCGTCGGGGAAA--TGCGAGGGGATGGCCTGTCCATCTCCCTCTCCAGCTTGGACCTCAGATCAGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!