Specimen Information

Sample Storage
Sample ID: EDNA09-01004
Catalog Number: E00386643
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Marchantiophyta
Class: Jungermanniopsida
Order: Jungermaniales
Family: Herbertaceae
Genus: Herbertus
Species: Herbertus hutchinsiae
Sample Collection
Ocean:
Country: Ireland
State:
Region: vcH16: West Galway
Exact Site: North slope of Benbaun above Kylemore Lough, Twelve Bens
Latitude:
Longitude:
Coordinate:
Collectors: D.G. Long
Collectiondate: 2004-07-23
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: HERB008-11
Marker Code: ITS
Residues: 712
CCTCCGG-GAGTGAGTTGTT----GGCGGTCGAGGTCGGGCCCTCCCCTCCCCCCTCTGTCCCTGTCTTTGGGGACTCGGGGGCCGATTTTTCCACAAGCAGCTTGAGGAACGTGAATTCAGAGACTGAGCATGGGGTCCTAGTCTTGCTCTCATGGGTGAGAGTTCGGGGCCCCGAGTTGAAAACCAAAACAACGACTCTCAGCAACGGATATCTTGGCTCTTGCAACGATGAAGAACGCAGCGAAATGCGATACCTAGTGTGAATTGCAGAATTCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTTGTCCCGAGGGCATGCCTGCCTGAGCGTCACCGCACTCCCACTCCCGTGGTTACATCTCGGTTTGCGGACCGGGGG---TGCTACCGAGAGTGGAACTGGCCGTCCGGGACCCGGCGTGAAGCCGATG--GTCGCGGTTGGCTGAAATGCAGTGTTCTGGACGCAGCTTAAGAGAGGGGCCGCGAGAAGGTGATCCGCCCCTCGCCGGGCGGAGTCAAAAGACAGCGGTTCTCTCGCTTGGGTGGTCCGGGATGACCGCGGCGGGGCACGGCTCCGTTGGGGAAA--TGCGAGGAGATGGCTTGTCCATCTCC-TCTCCAGCTTGGACCTCAGATCAGGCAAGATTACCCGCTGAGTTTAAGCATATCACTAAGCGGAGGAAAAGAAACTAAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!