Specimen Information

Sample Storage
Sample ID: CCMP288
Catalog Number: CCMP288
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Haptophyta
Class: Prymnesiophyceae
Order: Prymnesiales
Family: Prymnesiaceae
Genus: Chrysochromulina
Species: Chrysochromulina camella
Sample Collection
Ocean:
Country:
State:
Region: Sargasso Sea
Exact Site:
Latitude: 29.9689
Longitude: -63.8578
Coordinate: NULL
Collectors: M. Keller
Collectiondate: 1984-08-25
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: HAPT051-08
Marker Code: COI-5P
Residues: 620
GTATTAAAGTTACGGTCGGTTAATAACATTGTAATAGCACCGGCTAGTACAGGTAATGATAACAATAATAAAAAAGCTGTGATATAAACAGCTCACACAAATAACGGTGTTCGGTGTGCTGTCATACCTGGTGCTCGCATGTTTGTTATGGTAACAATAAAGTTAATAGCACCTAAGATTGAAGAGACACCAGCTAAATGCAAAGAATAAATAGCACAATCAACAGATGCTCCAGAGTGGGCTTGAATACCTGATAAAGGTGGGTAAACAGTTCAACCTGAACCAACACCAGCTTCAACTAAAGAAGATGAAATTAATAATAGCAATGATGGTGGTAGTAATCAAAAGCTAATATTATTTAAACGCGGAAATGACATATCACAAGCACCAATTAAAATAGGCACAAATCAATTACCAAAACCACCGATAGCCGTTGGCATTACGAAAAAAAAAATCATCAAAAAAGCGTGTGATGTGATTAACACGTTATATAATTGATAATTACCGGATAAAAAAGCGTCACCTGCTTGACTTAGTTCTAAACGCATAAACATTGAAACTACAAAACCTAGAATACCTGAAAAGGCACCGAAGATAAAATATAACGTTCCAATATCTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||

Photograph

No image available currently!