Specimen Information

Sample Storage
Sample ID: CCAP913-8
Catalog Number: CCAP913-8
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Haptophyta
Class: Prymnesiophyceae
Order: Coccosphaerales
Family: Coccolithaceae
Genus: Coccolithus
Species: Coccolithus sp.
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate: NULL
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: HAPT048-08
Marker Code: COI-5P
Residues: 694
AAAGATATTGGTACACTTTATATCATTTTTGGCGCGTTCTCTGGTATCCTGGGAACTTGTTTTTCGATACTTATTCGGATGGAGCTTTCACAGCCGGGTAATCAAGTGCTTGCAGGAAACCATAATCTTTACAACGTCATCATTACAGCACATGCTTTTCTTATGATTTTTTTTATGGTTATGCCAACACTCGTTGGCGGTTTTGGGAATTGGTTTGTACCGCTTCTTATTGGTGCTCCTGACATGGCTTTTCCACGTCTAAATAACATCAGTTTTTGGCTACTACCTCCGTCTCTCGTTCTTCTTCTTAGTTCTGCTCTTGTGGAAGTAGGTGCTGGTACAGGTTGGACAGTATACCCCCCACTTTCTAGTATTCTTGCTCATTCTGGGGGGGCGGTTGATCTTGCAATTTTTTCTCTTCACCTTTCTGGAATTTCGTCTATTCTAGGAGCTATTAATTTTATTACAACCGTTTTTAATATGCGCGCTCCTGGTATGGCTATATATCGTCTTCCGCTTTTTGTTTGGTCAATTCTCATTACAGCGTTTCTTCTTCTCCTTAGTCTGCCTGTTCTTGCGGGAGCTATTACTATGCTTCTCACTGACCGAAATTTCAATACAAGCTTTTTTGACCCTGCTGGTGGTGGAGACCCTATTCTGTATCAACACCTTTTTTGATTTTTTGGTCACCCGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!