Specimen Information

Sample Storage
Sample ID: UIO BOF
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Haptophyta
Class: Prymnesiophyceae
Order: Coccosphaerales
Family: Coccolithaceae
Genus: Emiliania
Species: Emiliania huxleyi
Sample Collection
Ocean:
Country: Norway
State:
Region: South Norway
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors: E. Paasche
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: HAPT019-07
Marker Code: COI-5P
Residues: 673
AAAGATATTGGTACTTTATATTTACTTTTTGGTGCTATGTCTGGTGTATTTGGAACTCTACTATCAATTTTAATTAGAGTTGAATTATCTGCACCAGGTAATCAAATTTTTAACGGTAACCACCAAGTATATAACGTTGTAGTAACTGCTCATGCATTTATTATGATTTTTTTTATGGTAATGCCTATTTTAATTGGGGGGTTTGCTAACTGGTTCGTTCCTTTATTAATTGGAGCCCCAGATATGGCTTTTCCTAGATTAAATAATATTAGTTTTTGGCTATTACCTCCTTCATTTTTATTATTAGCATCTTCAGCATTAGTTGAAGGTGGAGCTGGTACTGGGTGGACTGTATACCCACCTTTAAGTAGTATTTTAGCTCACTCTGGTCCTTCTGTAGATTTAGCCATTTTTAGTCTACATTTAGCAGGTGCTTCTTCTATTTTAGGATCAATTAATTTTATTGTAACTATTTTTAATATGAGAGCTGTAGGGATGACTTTACATAGAATGCCTTTATTTGTATGGTCAGTCCTAGTAACTACTTTTTTATTATTAGTATCATTACCAGTATTAGCAGGTGCTATTACCATGTTATTAACTGATAGAAATTTTAATACTACCTTTTTTGATCCTGCTGGAGGTGGAGATCCTGTTTTATACCAACATTTAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!