Specimen Information

Sample Storage
Sample ID: BC ZSM Lep 01568
Catalog Number: BC ZSM Lep 01568
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Axel Hausmann
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Family: Geometridae
Genus: Acasis
Species: Acasis viretata
Sample Collection
Ocean:
Country: Germany
State: Bavaria
Region: central
Exact Site: Regensburg - Kallmuenz
Latitude: 49.1678
Longitude: 11.9452
Coordinate:
Collectors: A. Segerer
Collectiondate: 2000-06-23
Specimen Details
Sex: male
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GWORC1568-08
Marker Code: COI-5P
Residues: 589
ATAGTAGGAACTTCTCTTAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGGTCTTTAATTGGGGATGATCAAATTTATAACACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTGCCCCTAATATTGGGGGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCCTCAATCACCCTGCTAATTTCGAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTTTACCCGCCTTTGTCCTCTAATATTGCCCATGGAGGAAGATCTGTAGATCTAGCTATTTTTTCCCTACATTTAGCAGGAATTTCTTCAATCCTGGGAGCAATTAATTTTATTACAACTATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCTTTATTTGTATGAGCGGTAGGAATCACAGCTTTCCTTCTCTTATTATCTTTACCTGTATTAGCTGGGGCAATCACAATACTATTAACAGACCGTAATCTTAATACTTCATTTTTTGACCCTGCAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.