Specimen Information

Sample Storage
Sample ID: BC ZSM Lep 02729
Catalog Number: BC ZSM Lep 02729
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Axel Hausmann
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Family: Geometridae
Genus: Acasis
Species: Acasis viretata
Sample Collection
Ocean:
Country: Germany
State: Bavaria
Region: south
Exact Site: Schlagenhofen am Woerthsee
Latitude: 48.0436
Longitude: 11.1728
Coordinate:
Collectors: K. Ambil
Collectiondate: 2007-05-15
Specimen Details
Sex: female
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GWORA943-08
Marker Code: COI-5P
Residues: 658
AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGGACTTCTCTTAGATTATTAATTCGAGCAGAATTAGGAAACCCTGGGTCTTTAATTGGGGATGATCAAATTTATAACACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTGCCCTTAATATTGGGGGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCCTCAATCACCCTGCTAATTTCGAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTTTACCCGCCTTTGTCCTCTAATATTGCCCATGGAGGAAGATCTGTAGATCTAGCTATTTTTTCCCTACATTTAGCAGGAATTTCTTCAATCCTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCTTTATTTGTATGAGCGGTAGGAATCACAGCTTTCCTCCTCTTATTATCTTTACCTGTATTAGCTGGGGCAATCACAATACTATTAACAGACCGTAATCTTAATACTTCATTTTTTGACCCTGCAGGAGGGGGAGACCCAATTCTATACCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.