Specimen Information

Sample Storage
Sample ID: 06-JMS-0746
Catalog Number: 590430
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Jeffery M. Saarela
Taxonomy
Phylum: Magnoliophyta
Class: Liliopsida
Order: Poales
Family: Poaceae
Genus: Agrostis
Species: Agrostis capillaris
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site: City of Burnaby Works Yard, just E of Willingdon overpass between Douglas Road and Willingdon Rd. Dry mud flats with Juncus.
Latitude: 49.261
Longitude: -122.989
Coordinate:
Collectors: Jeffery M. Saarela
Collectiondate: 2006-07-10
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GRASS935-07
Marker Code: matK
Residues: 825
TTAGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCAACTACTAT------TCAAATTGGAATAGTTTTATTACTTCAATGAAATCTATTTTTCTTTTTAAAAAAGAAAATAAAAGACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTATCATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAGGAAGATGGAACATTTTGGGATAATGTACCCGGTTTTTTTTCGGAAAACCATATGGTTCTTTATGGATCCTATGATGCATTATGTTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGTACCTTATCAATTTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAACCAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTGTACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAGATACTCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGCACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACANACTTTGTATCGCCNAAAGTATATACNT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!