Specimen Information

Sample Storage
Sample ID: 07-JMS-1028
Catalog Number: 590594
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Jeffery M. Saarela
Taxonomy
Phylum: Magnoliophyta
Class: Liliopsida
Order: Poales
Family: Poaceae
Genus: Agrostis
Species: Agrostis capillaris
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region:
Exact Site:
Latitude: 53.948
Longitude: -123.574
Coordinate:
Collectors: Jeffery M. Saarela & Diana M. Percy
Collectiondate: 2007-07-18
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GRASS1075-07
Marker Code: matK
Residues: 825
TTAGTGCAACTCCTTCAATACCGTATCCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCAACTACTAT------TCAAATTGGAATAGTTTTATTACTTCAATGAAATCTATTTTTCTTTTTAAAAAAGAAAATAAAAGACTTTTTCGATTCTTATATAATTCTTATGTATCAGAATATGAATTTTTCTTGTTGTTTCTTCGTAAACAATCTTCTTGCTTACCATTATCATCTTCTGGAACTTTTCTGGAACGAATCATCTTTTCTAGGAAGATGGAACATTTTGGGATAATGTACCCGGTTTTTTTTCGGAAAACCATATGGTTCTTTATGGATCCTATGATGCATTATGTTCGCTATCAAGGAAAGGCAATTCTTGGATCAAAAGGAACTCATTTTTTGAACAAGAAATGGAAATGGTACCTTATCAATTTGTGGCAATATTTTTTCTCTTTTTGGACTCAGCCGCGAAGGATCCATCTAAACCAATTAGCAAACTCTTGCTTCGATTTTCTGGGGTACCTTTCAAGTGTACCAAAAAGTACTTTGTTAGTAAGGAATCAAATGCTGGAGAATTTATTTCTAATAGATACTCGAATGAAAAAATTCGATACCATAGTTCCCGCTACTGCCCTCATAGGGCACTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAAACCCATTTGGACAGATTTATCAGATTGGGATATTCTTGATCGATTTGGTCGCATATGTAGAAATCTTTTTCATTATCATAGTGGATCTTCGAAAAAACAGACTTTGTATCGCCNAAAGTATATACNT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!