Specimen Information

Sample Storage
Sample ID: DQ176780
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Porifera
Class: Demospongiae
Order: Haplosclerida
Family: Lubomirskiidae
Genus: Baikalospongia
Species: Baikalospongia bacillifera
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBSP1238-06
Marker Code: COI-5P
Residues: 684
ACTCTTTATTTATTATTTGGAGCATTTGCAGGCATGATAGGTACAGCATTTAGTATGCTTATAAGATTAGAGCTATCAGCCCCTGGGTCAATGTTAGGGGAT---GATCAATTATATAATGTTATAGTTACAGCCCATGCTTTTCTAATGATATTTTTCTTAGTTATGCCAGTAATGATTGGGGGATTTGGAAATTGATTCGTGCCATTATATATTGGTGCACCCGATATGGCTTTTCCAAGATTAAACAATATTAGTTTTTGATTATTACCTCCGGCTTTAACTCTATTATTAGGATCTGCTTTTGTAGAGCAAGGGGTTGGTACAGGATGGACAGTATATCCCCCTTTAGCAGGCATACAAGCGCATTCTGGGGGATCGGTTGATATGGCAATATTTAGTCTTCACTTGGCGGGTATTTCTTCGATATTAGGGGCTATGAATTTTATCACAACAATCTTTAATATGAGAGCGCCCGGTATTACAATGGATAGACTGCCATTATTTGTATGATCTATTTTAATAACAGCCTTTTTATTATTATTATCTTTACCTGTATTAGCTGGTGGTATAACAATGCTTTTAACAGATAGAAATTTTAATACAACATTCTTTGATCCTGCTGGAGGAGGAGACCCAATACTATTTCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!