Specimen Information

Sample Storage
Sample ID: DQ079966
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Gnathostomulida
Class:
Order: Bursovaginoidea
Family: Gnathostomulidae
Genus: Gnathostomula
Species: Gnathostomula axi
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBSP1197-06
Marker Code: COI-5P
Residues: 660
ATAAACTACCTTTGATACGGTTTAACCACGGGATTCGTAGCAGCCGGACTAAGTATAATTATTCGGATCGAACTTGGAACAACAGGCTCAATCCTGATAAAC---GACCAAACCTACAATGTAGTAATCACAGCACACGGATTACTCATACTATTCTTTGTAGTCACTCCTGTTTTAATAGGAAGCTATGGAAACTTTTTTATCCCGATCATACTTAGATCACCAGATATGGCTTTCCCACGAATAAACAACTTAAGCTTCTGAATAGCAATCCCCGCGTTTATGCTTCTTATTAGAAGAAGCATGATAGAAGGTGGAGCAGGCACAGGTTGAACTGTTTACCCTCCCCTATCTAGTATTGAGTTTCACTCGAGAGTAGCAGTAGATTTAGCTATTTTTTCTCTCCATTTTTCGGGGGTATCCCTAATCCTAGGGTCTGTAAATTTTATTGCCACTATCACAAACATACGAACTTCAGCACTTTTCCTAATACGGATTAACCTATACACATGATCAATCTTTATCACTTCCGTCCTGTTGATTATTTCTCTTCCAGTGTTTGCTGGAGCCATCACTATACTGTTAGTGGATCGAAATTTCAACTGTTCATTTTTCGACCCAATAGGAGGAGGAAACCTAATTTTATACCAACACCTTTTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!