Specimen Information

Sample Storage
Sample ID: AY598776
Catalog Number: 2358b
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Roberto Bertolani
Taxonomy
Phylum: Tardigrada
Class: Eutardigrada
Order: Parachela
Family: Macrobiotidae
Genus: Xerobiotus
Species: Xerobiotus pseudohufelandi
Sample Collection
Ocean:
Country: Italy
State: Reggio Emilia
Region: Emilia Romagna
Exact Site: Calvario Mountain (moss on soli)
Latitude: 44.4398
Longitude: 10.977
Coordinate:
Collectors: Roberto Bertolani
Collectiondate: 2001-07-04
Specimen Details
Sex:
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBSP0594-06
Marker Code: COI-5P
Residues: 633
TTTGGGCTGTGGGCTGCTTGTGCTGGCACTTCACTAAGATTTATTATTCGAAGAGAATTAAGACAACCTGGCCTACTTTTTTCTGAC---GAACAAATATATAATGTAACTGTAACTAGACATGCTTTTATCATAATTTTTTTCTTTGTTATGCCAACCCTTATTGGAGGTTTCGGCAATTGATTAGTGCCTCTAATAATTAGAGCACCAGACATGGCCTTCCCTCGAATAAATAACTTAAGATTTTGACTTCTCCCTCCTTCATTATTGTTAATCATGTCTAGTACAATGAGAGAACAGGGGGCCGGGACAGGGTGAACAGTATACCCACCCCTGTCCCACTTCTTTGCCCACAGAGGCCCGAGAGTAGATTTAACAATTTTTTCCCTTCACGTAGCTGGGGTGTCGTCAATTCTAGGTGCAATTAATTTCATTTCTACTATTATTAATATGCGGGCTCCAGCCATTTCACTTGAAAAAATACCACTCTTCGTGTGAAGTGTGTTAATTACTGCTATTCTTCTTTTGCTAGCTCTTCCTGTACTAGCAGGAGCTATTACAATGCTTTTAATGGATCGAAATTTTAACACTTCCTTTTTTGATCCTGCTGGAGGTGGAGATCCTATTTTATAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||

Photograph

No image available currently!