Specimen Information

Sample Storage
Sample ID: AY598771
Catalog Number: 2389a
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Roberto Guidetti
Taxonomy
Phylum: Tardigrada
Class: Eutardigrada
Order: Parachela
Family: Macrobiotidae
Genus: Dactylobiotus
Species: Dactylobiotus parthenogeneticus
Sample Collection
Ocean:
Country: Italy
State: Modena
Region: Emilia Romagna
Exact Site: Sassomassiccio (sediment of a fountain)
Latitude: 44.1941
Longitude: 10.5255
Coordinate:
Collectors: Roberto Guidetti
Collectiondate: 2001-09-10
Specimen Details
Sex: female
Life Stage: adult
Reproduction: asexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBSP0589-06
Marker Code: COI-5P
Residues: 627
TTTGGGCTATGAGCAGCCACAGTTGGGACATCCCTAAGCTTTATTATTCGATCAGAATTAAGCCAACCAGGCTCAATTCTAAACGAT---GACCAAATATACAACGTAATTGTAACAAGACATGCTTTTATCATAATTTTCTTCTTTGTAATACCTATTTTAATTGGGGGGTTTGGAAACTGATTAGTCCCCCTAATGATTGGAGCCCCAGACATAGCGTTCCCACGAATAAACAACTTAAGATTCTGATTACTACCGCCATCCTTCTTACTAATCACAAGAGGTACCATAAGAGAACAAGGGGCAGGCACAGGATGAACAGTGTATCCACCACTCTCTCAATATTTTGCCCACAGAGGACCAAGAGTAGACCTAACCATCTTCTCTTTACACATTGCAGGAATCTCCTCTATCTTAGGAGCAATTAACTTTATCTCCACAATTATCAATATACGATCTCCAGCCATAAGAATAGAAAACATACCCTTATTTGTATGATCAGTGCTAATCACAGCAATCCTACTATTACTAGCATTACCAGTACTTGCAGGTGGAATTACAATACTGCTACTAGACCGTAACTTCAATACCTCATTCTTTGATCCTGCGGGGGGAGGTGACCCAATT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||

Photograph

No image available currently!