Specimen Information

Sample Storage
Sample ID: AY545549
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chaetognatha
Class: Sagittoidea
Order: Phragmophora
Family: Spadellidae
Genus: Spadella
Species: Spadella cephaloptera
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBSP0558-06
Marker Code: COI-5P
Residues: 901
GTTCGATGATTTTGTTCAACTAATCACAAAGATATTGGGACATTATATTTTTTGTTCGGGGCGTGGTCCGCATTTCTAGGGACTGCATTAAGAGAGTTAATTCGATTGGAATTAGGTCACCCAGGGTCGTTGATTGGAGAC---GATCAAATTTACAACGTAGTAGTAACAGCGCATGCGTTTGTAATAATCTTTTTTTTTGTTATACCCCTATTAATTGGTGGCTTTGGGAACTGGTTTGTACCCTTAATAATTCATGCCCCAGATATGGCATTTCCTCGGATGAATAATATGAGGTTCTGACTATTACCTCCATCTTTAAGGTTGCTGCTGTCTTCTTCAATTGTGGAAGCGGGTGCAGGAACAGGCTGGACAGTCTACCCCCCCTTATCCTCAATAGTAGGACATCCAGGGGGTGCCGTGGATTTAGCTATTTTTTCTCTCCATTTAGCGGGTGTGTCTTCTATTTTAGGCGCTGCAAACTTTATTACTACGATTCTTAATATGCGAGCCCCAGGGATAGATCTTGACCTCATGCCATTGTTTGTGTGAAGAATTTTTCTGACTGCTATTTTGTTACTCCTATCACTTCCGGTATTAGCAGGTGCTATTACAATATTACTAACAGATCGAAATTTTAATACTTCTTTCTTTGACCCGGCCGGGGGAGGGGACCCAATTTTGTACCAGCACCTATTTTGGTTCTTTGGTCATCCAGAGGTATATATTTTGATTCTCCCAGGCTTTGGAATTGTATCCCAAATTATTGTTACATATTCTGGAAAGGGAAACACTTTTGGCTCTTTGGGGATAATTTACGCTATATCAGCGATTGGATTATTAGGATTTGTAGTTTGGGCTCATCATATGTTTACCGTGGGAATAGATGTAGACACTCGGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|

Photograph

No image available currently!