Specimen Information

Sample Storage
Sample ID: AF417000
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Acanthocephala
Class: Archiacanthocephala
Order: Oligacanthorhynchida
Family: Oligacanthorhynchidae
Genus: Oncicola
Species: Oncicola sp. GCL-2002
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBSP0291-06
Marker Code: COI-5P
Residues: 660
ATGATATATTTTATTTCTTCATTATGGAGAGGTTTGATAGGGGTTGTAATAAGGTTAATTATTCGTTTAGAGCTGGGAAGGGTTGGGTCGTTACTAATGGAC---GACCACTTGTATAATGTGCTAGTTGGATCACATGCTGTTATAATGATTTTCTTTTTAGCAATACCGGTGATAATAGGAGGGTTTGGTAATTGGCTAATTCCTATTATGTTGGGAGTAGGGGATATAGCTTTTCCACGGTTAAATAATTTTAGGTTTTGACTACTTCCAGTTTCTATGACGTTTATAATAATGTCCCTGATGATAGGGGGT---TCTGGTTCAGGGTGGACTATTTACCCTCCTTTAAGTAGGTGGGTTTATAGAAGTGGAGCATCTGTGGATTTGATGGTTTTAGCCTTACATGTGGCGGGTATTTCATCTGTATTAGCTTCTGTGAATCTGATGGCCACTGTATGGGGTGCATGTAGTAGTGGGGTAAGTTTTGAGAAGTTGACTTTATTTACATGGTCTTTGATGGTCACTGCAGGGCTGATTATTTTAACTGTTCCTGTTTTAGCAGCAGCTTTAACCATATTGTTGTTGGACCGAAATTTAATGACTACTTTCTTTGACCCTTCTGGAGGGGGTAGGGTGATTATGTATCAGCATTTGTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!