Specimen Information

Sample Storage
Sample ID: DAOM227046.ITS
Catalog Number: DAOM227046
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Ascomycota
Class: Leotiomycetes
Order: Helotiales
Family: Orbiliaceae
Genus: Arthrobotrys
Species: Arthrobotrys superba
Sample Collection
Ocean:
Country: Canada
State: Quebec
Region: Gatineau Park
Exact Site: Angel Falls
Latitude: 45.395
Longitude: -75.844
Coordinate:
Collectors: Keith Seifert
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBF221-08
Marker Code: ITS
Residues: 538
CATTACCAAAGAGTGAGAAATCGCTCTCTACCTGCTCGGTGGCCCTTGGGTCGCTGACCGGTCTACCCTTTGTGAACCAAAAAACCTTTTCGCTTCGGCAGCTGGGTGTAACCGCCCGTCAGCCTGCCGCTAGCACCAACCTTTAAAACCTGTTGTCAAACATTGTCTGATAACCAAATTTTCGAATGAAAATTAAAACTTTCAACAACGGATCTCTTGGTTCCCCCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCATTGGTATTCCTTTGGGCATGTCTGTTTGAGCGTCATTACAACCCTCAGCCAACCGCTGGTCATGGACCTGAACGGGGTAACACCCGAGCCGGTCTAAAAGTTGTAAGCTCTGCTGGCCGCTCTGCCCAACCGGAACATAGTAAAACACTACTTGTTGGGGTGAAGCTGAACGGTACGGCCTGAACAAAACCTACCCATTTCTAAGGTTTGACCTCAGATCAGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!