Specimen Information

Sample Storage
Sample ID: DAOM226844.ITS
Catalog Number: DAOM226844
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Ascomycota
Class: Sordariomycetes
Order: Sordariomycetes_incertae_sedis
Family: Apiosporaceae
Genus: Apiospora
Species: Apiospora montagnei
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region:
Exact Site: CEF
Latitude:
Longitude:
Coordinate:
Collectors: Dave Overy
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBF171-08
Marker Code: ITS
Residues: 526
CATTACAGAGTTATACAACTCCCATACCATCTGTTAACCTACCCAGTTATGCCTCGGCGTAAGCTCGGTTGGAGGCACCTGCAGCTACCCTGTAGTTGCGGACTGCCAACTCCAGCCGCGGCCCGCCGGCGGTACACTAAACTCTGTTTTATTTTATATTCTGAGCGTCTTATTTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATCAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTGCTGTACTGCAGTTCCTTAAAGACAGTGGCGGAGCGGCGGTAGTCCTCTGAGCGTAGTAATTTATTTCTCGCTTTTGTCAGGCTCTGTCCTCCCGCCATAAAACCCCCAATTTTTTAGTGGTTGACCTCGGATCAGGTAGGAATACCCGC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.