Specimen Information

Sample Storage
Sample ID: DAOM226647.ITS
Catalog Number: DAOM226647
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Ascomycota
Class: Dothideomycetes
Order: Dothideomycetes_incertae_sedis
Family: Dothideomycetes_family_incertae_sedis
Genus: Acrogenospora
Species: Acrogenospora gigantospora
Sample Collection
Ocean:
Country: Australia
State: New South Wales
Region: Blue Mountain Nat. Park
Exact Site: Neates Glen
Latitude: -33.652
Longitude: 150.315
Coordinate:
Collectors: Keith A. Seifert
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBF134-08
Marker Code: ITS
Residues: 564
CATTACCGAGCGCCCTCGGCCCTAACCGGGCCAGGCCTCCCATCCCGTGCCTGAACCCCTCTCTCCTTCCCTCCCGGGGGCGCGCCCCAAAAGGCCGCCCCCGGAAGGCAGAGGGCCACCGCCTCCTCTTCGGGCCCTAGGGCCCCGGAGCCGGCGGAGGACCCCCTAAAACCCTCGCGAAACCTACAGTCTGAGCGGCTCATGCCAAACCTAAATACAACCTGCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGCGAATCGCAGATCTCAGTGAGTCATCGAATTTTTGAACGCATATTGCGCCCTCTAGTATTCTGGAGGGCACGCCTGTCCGAGCGCCATTTTCAACCTCGAGCCCCCGGGCTCAGTGTTGGGCGTCGCCCGAGAGGGCCCGCCCCAAACGTGTCGGCGCCGCCCGCCGGAACCCAGCGCACCGTGCCTAACCGCCCGCGCGAAGGTCCCGGGGGGTGGCCGCCCGCAGCTAGCGCCCTGGCGCAACAAAGCATGGCCTCGGATCAGGCGGGGCTACCCGC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!