Specimen Information

Sample Storage
Sample ID: DAOM190558.ITS
Catalog Number: DAOM190558
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Ascomycota
Class: Ascomycotaincertaesedis
Order: Ascomycota_order_incertae_sedis
Family: Ascomycota_family_incertae_sedis
Genus: Acrospeira
Species: Acrospeira mirabilis
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors: B. Gill
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBF122-08
Marker Code: ITS
Residues: 538
CATTAGTGAATAAATAGGGTGTCCAATTTAACTTGGAGCCCAACCTTCTCACTTTCTAACCCTGTGCATCTGTATCTAACGGTGAGCTGCCTTCGGGTGGCGAGCCTTCACTTTAAAACACCAAGTCTATGAATGTATATAATCATAACTATATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCACTCTCTGGTATTCCGGAGAGTATGTCTGTTGGAGTGTCATGAATTCTTCAACCCCACCGTTTCTTGCAAACGCGTGGGTGCTTGGATTCTGAGCGCTGCTGGCTTCGGCCTAGCTCGTTCGTAATGCATTAGCATCCCGATGACAAGTTTGGATTGACTTGGCGTAATAGACTATTCGCTGAGGAGTAAGTGGCCTTCGGGTTACTGAGCCAACTCGTTTCAGGAAGCTTCTAATCCCTAAAGTCTACCTTTTAGATTAGATCTCC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.