Specimen Information

Sample Storage
Sample ID: DAOM226808.ITS
Catalog Number: DAOM226808
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Ascomycota
Class: Ascomycotaincertaesedis
Order: Ascomycota_order_incertae_sedis
Family: Ascomycota_family_incertae_sedis
Genus: Amerosporium
Species: Amerosporium polynematoides
Sample Collection
Ocean:
Country: Australia
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors: Keith Seifert
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBF108-08
Marker Code: ITS
Residues: 528
CATTACCGAGTTTACAAACTCCCAACCCTATGTGAACCTACCTATCGTTGCTTCGGCGGGCTTAGCCCCCGCGCCGCTCGCCGGCGCCGGGAAACAGGCGCCCGCCGGAGACCCAAACTCAATGTTTTTCATGCAGTATTATCTGAGTGGCAAACGCAAAAATAAATCAAAACTTTTAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCGAGTATTCTCGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAGGGCCCGCCTGCTTTGCAGGCGCGGCGCTGGTGTTGGGGATCGGCTACCCTGCCGTCCCCCAAATACAGTGGCGGTCTCGCTGCAGCCTTCCCCTGCGTAGTAGCAACACTCGCATGCGGAGCGCGGCGCGGCCACGCCGTAAAACCCCCGACTTTCTGAACGTTGACCTCGGATCAGGTAGGAATACCCGC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.