Specimen Information

Sample Storage
Sample ID: DAOM230096.ITS
Catalog Number: DAOM 230096
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Ascomycota
Class: Leotiomycetes
Order: Helotiales
Family: Dermatiaceae
Genus: Chaetomella
Species: Chaetomella acutiseta
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region: Renfrew
Exact Site:
Latitude: 45.633
Longitude: -77.065
Coordinate:
Collectors: Sarah Hambleton
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBF092-08
Marker Code: ITS
Residues: 423
CATTACCGAGTTGGCTCACGCCAATCTCCCTTTCTTGATGTTGACCGGTTGCCTTGCCTTCGGGCAGCATACTCTTATTAATTGTCGTCTGAGAACTTTATAATAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGACACCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTACACCTTCATATGGTCTTGGAGCATGTCTACGACAGCTCTTAAATATCTTGGTGGTAACTGAAACCCACGCAAAGTAATCTCTGCGAAGGCTTTCAGGTAAACACCGAAAAACCTCTTGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!