Specimen Information

Sample Storage
Sample ID: KAS759.ITS
Catalog Number: CBS 537.79
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Ascomycota
Class: Sordariomycetes
Order: Xylariales
Family: Xylariaceae
Genus: Arthroxylaria
Species: Arthroxylaria elegans
Sample Collection
Ocean:
Country: United States
State: California
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors: R.K. Benjamin
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBF035-08
Marker Code: ITS
Residues: 552
CATTAAAGAGTTCTAACAAACTCCCAAACCCATGTGAACATACCTTACGTTGCCTCGGCAGGTCGCGGCCTACCCGGTAACCCCCTACCCTGGGGGACCTACCCGGGAAGACGCGGTTCCAGCCTGCCGACGGCCCAGCAAACTCTGTTTAGCATTGAAAATCTGATTTATAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCCCAGTTGCTTAGCGTTGGGAGCCTACGGTTTCAGCGTAGCTCCTCAAAGTTAGTGGCAGAGTCAGTCCGCACTCTAGGCGTAGTAATTTCTATCTCGTCTTTGCAGTCGTGCTGCCGCTCGCCGTAAAACACCCCAATTTATAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!