Specimen Information

Sample Storage
Sample ID: EU012498
Catalog Number: EU012498
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Cnidaria
Class: Hydrozoa
Order: Hydroida
Family: Aequoreidae
Genus: Aequorea
Species: Aequorea sp. LMZ-2007a
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBCI792-07
Marker Code: COI-5P
Residues: 540
GATATTGGAACATTATATATTGTATTTGGTGCTTTTTCTGGTATGGTAGGAACCGCCTTAAGTATGCTTATTAGATTAGAATTAGCCGGACCTGGACCAATGTTCGGAGAC---GATCATTTATATAATGTTATTGTAACAGCTCATGCATTTGTTATGATTTTCTTTTTAGTTATGCCAGTGTTAATTGGAGGATTTGGAAATTGATTTGTTCCATTATATATAGGAGCCCCCGATATGGCATTCCCAAGATTAAACAATCTTAGTTTTTGATTATTACCTCCTGCTTTGTTATTATTATTAGGATCTTCTTTAATAGAACAAGGTGCTGGTACAGGGTGAACAGTTTACCCTCCTTTATCAGGACCCCAAACTCATTCTGGAGGTTCAGTAGATATGGCTATTTTTAGTTTACATTGTGCAGGTATTTCTTCTATTATGGGTGCTATAAATTTTATAACTACTATTTTTAATATGAGAGCTCCTGGTTTAACTATGGATAAACTTCCATTATTCGTTTGATCTGTATTAATAACAGCA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!