Specimen Information

Sample Storage
Sample ID: AF216203
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Arthropoda
Class: Merostomata
Order: Xiphosurida
Family: Limulidae
Genus: Limulus
Species: Limulus polyphemus
Sample Collection
Ocean:
Country:
State:
Region:
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: GBA0004-06
Marker Code: COI-5P
Residues: 915
Y-H-M-S-C-I---CCGCGATGACTTTATTCAACAAATCACAAAGACATTGGAACAATATATCTAATTTTTGGAATTTGAGCCGCAATAGTAGGGACAGCTCTCAGAATCTTAATTCGAGCCGAACTTGGCCAACCTGGCTCATTAATTGGAGAT---GATCAAATTTACAACGTAATTGTTACAGCCCACGCATTCGTAATAATTTTTTTTATAGTTATACCTGTAATAATCGGAGGATTTGGAAACTGACTTATTCCTCTAATATTAGGGGCCCCTGATATAGCTTTTCCCCGACTCAATAACATAAGCTTTTGACTTCTCCCCCCATCTTTTCTTCTATTACTCAGATCAGCTGCAGTAGAAAGAGGAGCAGGAACAGGTTGAACCGTATACCCTCCTCTAGCATCAGGTATAGCTCACGCAGGAGCCTCAGTAGACTTGACAATCTTTTCTCTCCACTTAGCAGGAGTATCATCAATTTTAGGTGCAATTAATTTCATTACCACAATTATTAATATACGAACATCCGGAATAGTACTTGAACGAATACCATTATTCGTTTGATCAGTTAAAATTACTGCAATCCTTCTTCTTCTATCTCTCCCTGTTCTTGCTGGAGCTATTACAATACTCCTAACAGATCGAAACTTCAATACATCATTTTTTGACCCTGCAGGAGGGGGTGACCCAGTCCTATACCAACATTTATTTTGATTTTTTGGGCACCCTGAAGTCTACATTTTAATTCTTCCTGGGTTTGGAATAATCTCTCATATTATTAGCCACCAAACAGGAAAAAAGGAACCTTTCGGGACTCTTGGAATAATTTATGCCATATTAGCTATTGGCATTCTTGGTTTTATAGTATGAGCTCACCATATATTTACAGTGGGAATAGACGTAGACACACGAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||

Photograph

No image available currently!