Specimen Information

Sample Storage
Sample ID: Gillespie_et_al_7958
Catalog Number: CAN592257
Voucher Type:
Voucher Description:
Institution Storing: Canadian Museum of Nature
Identification Provided by: Jeffery M. Saarela
Taxonomy
Phylum: Lycopodiophyta
Class: Lycopodiopsida
Order: Lycopodiales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Canada
State: Nunavut
Region: Victoria Island
Exact Site: Rocky hills south of large unnamed lake ca. 18 km ENE of Johansen Bay airstrip.
Latitude: 68.753
Longitude: -110.692
Coordinate:
Collectors: Gillespie, L.J.: Saarela, J.M.: Consaul, L.L.: Bull, R.D.
Collectiondate: 2008-07-14
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: FCA130-09
Marker Code: rbcLa
Residues: 552
AGTGTTGGATTCAAAGCTGGCGTTAGGGATTACAGATTAACTTATTACACTCCTAATTATAAGACCAAAGACACCGATATTTTGGCAGCATTTCGGATGACCCCCCAACCTGGAGTACCACCCGAGGAGGCGGGAGCCGCAGTAGCTGCTGAATCTTCCACTGGTACATGGACTACCGTTTGGACCGATGGACTTACCAGCCTTGATCGTTATAAGGGTCGATGCTATGAAATTGAAGCTGTGACCGGGGAGAAAAATCAATTTATTGCTTATGTAGCTTATCCTTTGGATCTCTTTGAGGAAGGTTCTGTCACTAACTTATTCACCTCCATCGTGGGTAATGTATTCGGATTCAAAGCTTTACGAGCTTTACGTTTAGAAGATTTGCGAATTCCCCCCGCTTATTCCAAAACTTTCATAGGTCCACCCCATGGTATCCAAGTTGAAAGAGACAAATCAAACAAATATGGCCGTCCTTTATTAGGATGTACTATTAAACCAAAATTAGGTTTATCTGCTAAAAACTATGGTAGAGCTGTTTATGAATGTCTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!