Specimen Information

Sample Storage
Sample ID: BC ZSM Lep 28175
Catalog Number: 19335:ZSM
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Andreas Segerer
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Family: Noctuidae
Genus: Acronicta
Species: Acronicta euphorbiae
Sample Collection
Ocean:
Country: Germany
State: Bavaria
Region: Oberbayern
Exact Site: Bergen b. Traunstein, Weissachental
Latitude: 47.765
Longitude: 12.5378
Coordinate:
Collectors: Dr. Andreas H. Segerer
Collectiondate: 1995-07-19
Specimen Details
Sex: male
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: FBLMV195-09
Marker Code: COI-5P
Residues: 658
AACATTATATTTTATCTTTGGTATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGTTTCTGACTTCTTCCCCCATCTTTAACTTTATTAATTTCAAGTAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCCCATGGAGGAAGTTCTGTAGATTTAGCTATTTTTTCCCTTCACTTAGCTGGAATTTCCTCAATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAGCTTATCATTTGATCAAATACCACTATTTATTTGAGCAGTAGGAATTACTGCATTCTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATCACAATACTTTTAACAGATCGTAATTTAAACACATCATTTTTTGACCCTGCTGGAGGAGGAGACCCAATCTTATACCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.