Specimen Information

Sample Storage
Sample ID: BC ZSM Lep 27054
Catalog Number: 49129:ZSM
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Andreas Segerer
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Family: Noctuidae
Genus: Abrostola
Species: Abrostola triplasia
Sample Collection
Ocean:
Country: Germany
State: Bavaria
Region: Oberpfalz
Exact Site: Regensburg, Kumpfmuehl
Latitude: 49.0063
Longitude: 12.0768
Coordinate:
Collectors: Dr. Andreas H. Segerer
Collectiondate: 2009-07-03
Specimen Details
Sex: male
Life Stage: adult
Reproduction: sexual
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: FBLMU404-09
Marker Code: COI-5P
Residues: 658
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTTGGAAATTGACTTATCCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGATTACTACCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCCCATGGAGGTAGTTCTGTAGACTTAGCTATTTTTTCATTACATTTAGCTGGAATCTCATCAATTCTTGGAGCAATTAATTTTATTACAACAATTATTAATATACGTTTAAATAGATTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCATTCTTATTATTACTTTCATTGCCTGTATTAGCTGGAGCAATTACAATACTTTTAACTGATCGTAATTTAAATACATCATTTTTTGACCCTGCTGGTGGGGGAGATCCTATTTTATACCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!