Specimen Information

Sample Storage
Sample ID: INV0794c
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Jim Boutillier
Taxonomy
Phylum: Arthropoda
Class: Malacostraca
Order: Decapoda
Family: Oplophoridae
Genus: Acanthephyra
Species: Acanthephyra curtirostris
Sample Collection
Ocean:
Country: Canada
State: British Columbia
Region: Pacific Ocean
Exact Site:
Latitude: 50.358
Longitude: -130.046
Coordinate:
Collectors: Jim Boutillier, Pacific Biological Station, B.C.
Collectiondate: 2006-10-08
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: Tow 8
   
   
   
   
   
   

Sequence Details

Sequence ID: DSCRA047-06
Marker Code: COI-5P
Residues: 650
TATATTTCATCCTTGGAGCATGAGCTGGAATGGTAGGTACCGCCCTAAGCCTTTTGATCCGGGCCGAACTCGGCCAACCAGGAAGCTTAATCGGAAACGATCAAATCTACAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATGCCGATTATAATTGGTGGCTTCGGAAACTGATTACTCCCCCTTATACTAGGAGCCCCTGATATAGCCTTCCCTCGAATAAACAACATAAGATTCTGGCTACTGCCCCCATCCTTAACCCTTTTACTCTCTAGAGGAATAGTAGAAAGGGGGGTTGGTACTGGATGAACTGTTTACCCCCCACTAGCTGCTGGGATCGCCCATGCTGGAGCTTCTGTTGATATAGCAATTTTCTCGCTCCATTTAGCTGGTATCTCTTCAATTCTAGGCTCCGTTAATTTCATAACCACAGTTATTAATATACGAAGAAGAGGAATGACGATAGACCGAATCCCCTTATTCGTTTGATCGGTGTTTTTAACCACAATCTTACTCCTACTCTCCCTACCTGTTCTAGCGGGAGCTATCACAATACTACTCACAGATCGAAACTTAAACACCTCCTTCTTTGACCCGGCTGGGGGAGGAGACCCAATTCTCTACCAACATTTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!