Specimen Information

Sample Storage
Sample ID: OLI-Peri-carch-CR03
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Eleni Gentekaki
Taxonomy
Phylum: Ciliophora
Class: Oligohymenophorea
Order: Peritrichia
Family: Vorticellidae
Genus: Carchesium
Species: Carchesium polypinum
Sample Collection
Ocean:
Country: Canada
State: Ontario
Region: Connestogo River
Exact Site:
Latitude:
Longitude:
Coordinate:
Collectors: Eleni Gentekaki
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: environmental sample
   
   
   
   
   
   

Sequence Details

Sequence ID: DLPR094-10
Marker Code: COI-5P
Residues: 819
GATGTTGCTTATCCAAGATTAAATAACTTAGGTTTCTGAATTCAGCCTTGTGGATTTTTATTAATAGCTAAAATGGGTTCTATGAGATTAGAATACTGAACTACTGAAGTCAAAACTTCTTTTTTTTCTGGATTAACTAAAGTGGATAATTTTTTACAACAATATAAATACGATGAAATTTTTCATAATATTAAAAAATCTATTAGTAATTACGATTATTCAAGACTAGAATTATTAGTAAAAGATGCTACA------AAAGATATTGATAAAAAACTACATGATTTTGTTACTTATAGAAAATTGAGAGATCAGGCTATTCTTGATGCTGAATTACACAAAGGAATGAAATATAATCTGAATATTTTCGATGAAAATTTTTATAGTTATAAATTAATTTTTTGAAAAGATATTTATAATTCTACTGATACTTTTTGATCATTAACAAAAAATGCTTTAAAGTTTAAAAGACAAAAAAGATTTTTAGTTAAATGTATTAGTGCTAACCAAACAGTTGCTGGTTGAACTTTTATTACACCATTTTCATCAAATACAGAATATACGGGGTTCGGTATTCAAGATATGTTAATTTTAGGGGTATATTATGCTGGTATTAGTACAACTATTAGTTTAGTTAATTTATTAATAACTAGAAGAACTTTATCTATGCCTGGTTTAAGAAATAGAAGAATTTTATTACCATTCATTACAATTACACTTTTATTGATGTTACGTGCTTTATCCGTAATTACACCGGTATTGGGTTCTGCTATGTTGATGTTATTAACTGATAGACACTGAAAAACATCCTTTTTTGAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!