Specimen Information

Sample Storage
Sample ID: PR834
Catalog Number: PR834
Voucher Type:
Voucher Description:
Institution Storing: University of Johannesburg
Identification Provided by: Philip Rousseau
Taxonomy
Phylum: Cycadophyta
Class: Cycadopsida
Order: Cycadales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: South Africa
State: Gauteng
Region:
Exact Site: University of Pretoria, Manie van der Schiff Botanical Garden in cultivation.
Latitude: -25.7567
Longitude: 28.2333
Coordinate:
Collectors: Philip Rousseau, Susan Myburgh
Collectiondate: 2010-01-18
Specimen Details
Sex:
Life Stage: adult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: CYAF179-10
Marker Code: rbcLa
Residues: 552
AGTGTCGGATTTAAAGCTGGTGGTAAAGATTACAGATTAACTTATTACACTCCTGAATATAAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCCCAACCTGGGGTGCCCGCTGAGGAAGCGGGGGCTGCAGTAGCTGCTGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGGGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTCTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTAGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCCTATTGGGATGTACCATTAAACCAAAATTGGGTTTATCTGCCAAAAACTATGGTAGAGCAGTTTACGAATGTCTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser.

Sequencing Runs (Reverce)

If you see this text, it means that you are not using a java capable browser.