Specimen Information

Sample Storage
Sample ID: PR813
Catalog Number: PR813
Voucher Type:
Voucher Description:
Institution Storing: University of Johannesburg
Identification Provided by: Philip Rousseau
Taxonomy
Phylum: Cycadophyta
Class: Cycadopsida
Order: Cycadales
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: South Africa
State: Gauteng
Region:
Exact Site: Cycad World of Innovations nursery, Pretoria North, in cultivation
Latitude: -25.7467
Longitude: 28.1867
Coordinate:
Collectors: Philip Rousseau, Adolf Fanfoni
Collectiondate: 2010-01-08
Specimen Details
Sex:
Life Stage: immature
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: CYAF158-10
Marker Code: rbcLa
Residues: 524
AGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTAACTTATTACACTCCTGAATATAAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCCCAACCTGGGGTGCCCGCTGAGGAAGCGGGGGCTGCAGTAGCTGCTGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGGGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTCTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTAGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCCTATTGGGATGTACCATTAAACCAAAATTGGGTTTATCTGCCAAAAA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!