Specimen Information

Sample Storage
Sample ID: CTM0042
Catalog Number:
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by: Alma E. Garcia
Taxonomy
Phylum: Rotifera
Class: Eurotatoria
Order: Ploima
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Mexico
State: Veracruz
Region: Los Tuxtlas
Exact Site:
Latitude: 18.549
Longitude: -94.968
Coordinate:
Collectors: A.E.Garcia,K.Maya
Collectiondate: 2010-08-28
Specimen Details
Sex: female
Life Stage: adult
Reproduction: parthenogenesis
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: CTM042-10
Marker Code: COI-5P
Residues: 661
GACTTTATATTTTATTTTTGGTATGTGAGCTGGATTTATTGGATTAAGAATGAGACTTTTAATTCGTTTAGAATTAGGTGTTGTTGGTCCTTATCTAGGAGATGAACATTTGTATAATGTTTTAGTTACGGCTCATGCTTTTATTATAATTTTTTTTATGGTGATGCCAATTTCTATAGGAGGTTTTGGAAATTGACTAATTCCTTTAATGTTGGGTGTTGCCGATATGGCTTTTCCTCGTATGAATAATTTATCTTTTTGATTATTGATCCCATCTTTTATGTTTTTATTATTGTCTTCTATTTTGGATGCTGGTGTTGGAACTGGTTGAACAGTTTACCCACCTTTAGCAGATGCTAAGTATCATAGAGGTATTTCAGTAGATTTAGCTATTTTTAGTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGTAGAATTAATTTTTTGACTACAATTATTTGTTCTCGAACTACTAAGAAAATTTCTTTAGATCGTCTTCCTCTTTTATTATGAGCCTTAGCTGTTACTGCCGTTTTATTAGTTACTAGATTACCAGTTTTAGCTGGTGCAATTACTATACTTTTAACTGATCGTAACTTTAATACATCTTTTTTTGATCCAGCAGGAGGTGGTAATCCTGTTTTATACCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!