Specimen Information

Sample Storage
Sample ID: CCAP 978-13
Catalog Number: CCAP 978-13
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Cryptophycophyta
Class: Cryptophyceae
Order: Pyrenomonadales
Family: Chroomonadaceae
Genus: Chroomonas
Species: Chroomonas salina
Sample Collection
Ocean:
Country: United Kingdom
State: England
Region: Essex
Exact Site: Fambridge Marshes
Latitude: 51.38
Longitude: 0.4
Coordinate:
Collectors:
Collectiondate:
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: Brackish
   
   
   
   
   
   

Sequence Details

Sequence ID: CPTO029-09
Marker Code: COI-5P
Residues: 622
ATTTTTTCTGGTGTTGTGGGAACAACTCTTTCAGTTTTAATAAGAGCTGAACTTTCTGGTCCTGGTGTACAAGTTTTAGGTGGTAACCATCAACTTTATAATGTGATCGTAACTGGTCATGCTTTTATAATGATATTTTTTATGGTGATGCCTGCTTTAATTGGAGGTTATGGTAACTTTTTAGTTCCTATTATGATTGGTGCTGTTGATATGGCATTTCCAAGAATGAATAATGTTAGTTTTTGGCTTTTACCACCAGCGTTATTATTATTAATTAGTTCTACTTTAACAGAAGGTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTGAGTAGTGTTGAAGGTCACCCAAGTGCTGCCATCGATTTAGGAATCTTTAGCTTACATGTTGCGGGAGCTTCTTCTATTTTAGGTGCTATTAATTTTATTACCACAATTTTTAATATGCGATGTCCTGGTATGACATTTCATAGATTGCCTCTTTTTGTTTGGGCAGTTTTAATTACAGCATTTTTATTACTTTTATCTTTACCTGTTTTTGCGGGAGCAATTACAATGTTATTAACAGATAGAAATTTTAATACAACATTCTTTAATCCAGCTGGTGGAGGTGATCCTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||

Photograph

No image available currently!