Specimen Information

Sample Storage
Sample ID: CCMP2757-Nu-ITS
Catalog Number: CCMP2757-Nu-ITS
Voucher Type:
Voucher Description:
Institution Storing:
Identification Provided by:
Taxonomy
Phylum: Chlorarachniophyta
Class: Chlorarachniophyceae
Order: Chlorarachniales
Family: Chlorarachniaceae
Genus: Bigelowiella
Species: Bigelowiella natans
Sample Collection
Ocean:
Country:
State:
Region: Sargasso sea
Exact Site:
Latitude: 34.7166
Longitude: -66.5
Coordinate:
Collectors:
Collectiondate: 1981-06-24
Specimen Details
Sex:
Life Stage:
Reproduction:
Notes: From Oceanus 100 cruise. Strain synonym CCMP621.
   
   
   
   
   
   

Sequence Details

Sequence ID: CHLOR017-07
Marker Code: ITS
Residues: 779
GCCCTTGTAGGTGAACCTGCAGAAGGATCATTAACRCGTATCCACGTTATAATAAACTTTATAAATCTTTGTGAACTTGTAGACTGTGAACCCTTTTTTATTACAACAACAACAAACTCCTTTATTGGAACTAAAAATTTTTATTGTCGAAAATTACATCTTATTATCTCTCATAATCTTCATTATTRTGRGAAATARTATRAAAAACAATATCATGACCCTTAGCGAAGGATGTCTTGGTTCCGGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGCGAATTGCAGAATTCAGTGAATCATCAAATTTTTGAACGCAAATTGCGCTCCGTAGGTGTCCCCTTGGAGCATGCCTCCTTCAGTGTCGTGTCTACCAATCTCAGCGACGTGCTTATTCGAAATGATGAGCACATGTAGCTGGAAAGTGAGTGTCACTTCATTGGAGTGTCGCTTGAAGACGACAGGTTGTTGGTTGCATTTCTTCCTATTTTTTTCACAACAAAAATAGAGAAGAGTGCGATCCGACAGATTTCACGACTAGCTTTGCAGTTGGTGTGATGTGGGTAGCCTTATGGACGAAACATCTAACCGTATATTAAATTATAGCTGCTGTAGGCTAGGCACCAAAAAGAGATCGTCGGAAGCAACGACAAAGATCATACAACTGGAATATTCTCGAATCATTTATTAATGAATGATGAGAGATATTTTCGACTGTTGACCTGAAGTGAGGTGAGAGGACCGGCCGAATTTAAGCATATAAGGGCGAATTCC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Photograph

No image available currently!